View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2524_high_20 (Length: 289)
Name: NF2524_high_20
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2524_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 30 - 272
Target Start/End: Complemental strand, 1673089 - 1672838
Alignment:
| Q |
30 |
tatgatgtattatactaaacattaattaattgatgaatatgtgttggactttgttttgaatgaattgtg---------accatttttaaattaaatgaga |
120 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |||||||||| |
|
|
| T |
1673089 |
tatgatgtattatattaaacattaattaattgatgaatatgtgttggactttgtttggaatgaattgtggtcagttagaccatttttaagttaaatgaga |
1672990 |
T |
 |
| Q |
121 |
ggtatatgttctcattcgtgtaactacttatatgttattctaaaatatgattaaatataaggtgaaaatctaacttatacaattaaattcggacgacaat |
220 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1672989 |
ggtatatgctctcattcgtgtaactacttatatgttattctaaaatatgattaaatataaggtgaaaatctaacttatacaattaaattcggacgacaat |
1672890 |
T |
 |
| Q |
221 |
taaggtagttcttttatcatattgttatctcgctatttgtcatcgttatcct |
272 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1672889 |
taagatagtttgtttatcatattgttatctcgctatgtgtcatcgttatcct |
1672838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University