View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2524_high_36 (Length: 237)

Name: NF2524_high_36
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2524_high_36
NF2524_high_36
[»] chr1 (2 HSPs)
chr1 (83-166)||(32886883-32886966)
chr1 (27-71)||(32886537-32886581)


Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 83 - 166
Target Start/End: Original strand, 32886883 - 32886966
Alignment:
83 gagcctaaagtgaacctcataatattagtcagagaatgaaatctagttcgacacattgaggctcttacaaaaatttactcttta 166  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
32886883 gagcctaaagtgaacctcataatattagtcagagaatgaaatctagttcgacacattgaggctcttacaaaaatttacacttta 32886966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 27 - 71
Target Start/End: Original strand, 32886537 - 32886581
Alignment:
27 cacatgaaaagatgaagacatacatgctactctaccatttcaaaa 71  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
32886537 cacatgaaaagatgaagacatacatgctactctaccatttcaaaa 32886581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University