View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2524_low_17 (Length: 334)
Name: NF2524_low_17
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2524_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 16 - 299
Target Start/End: Original strand, 10227486 - 10227769
Alignment:
| Q |
16 |
gttgaaagcagatataatcttttgtggtagtcaaaagcgaaagtaaacatacttatagtaatgaaaaacatatttaactttannnnnnnaagtagaattc |
115 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
10227486 |
gttgaaagtagatataatcttttgtggtaatcaaaagcgaaagtaaatatacttatagtaatgaaaaatagatttaactttatttttttaagtagaattc |
10227585 |
T |
 |
| Q |
116 |
gagttgagttgtnnnnnnnnnttattttaacatcgttgaatgttctttgtnnnnnnntattattgttattactgctttattgtannnnnnnnnaatgcat |
215 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||| ||| |
|
|
| T |
10227586 |
gagttgagttgtaaaaaaaa-ttattttaacatcgttgaatgttctttgtaaaaaaatatg-ttgttattactgctttattgtatttttttttaatccat |
10227683 |
T |
 |
| Q |
216 |
gaaatggctttaactttaacaataaaacttgagtcgactaggtttgg--ttttccttaatttcaaaatttagaaatgtatttttta |
299 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10227684 |
gaaatggctttaactttaaccataaaacttgagtcgactaggtttgggtttttccttaatttcaaaatttagaaatgtatttttta |
10227769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University