View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2524_low_18 (Length: 310)
Name: NF2524_low_18
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2524_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 177 - 268
Target Start/End: Complemental strand, 39784832 - 39784741
Alignment:
| Q |
177 |
tacttgctagcaaatgttgcatcctttgttctctccccatcttcatggcttcaaagttgggaatatatgtcccttcatcattaaggcactgt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39784832 |
tacttgctagcaaatgttgcatcctttgttctctccccatcttcatggcttcaaagttgggaatatatgtcccttgatcattaaggcactgt |
39784741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 18 - 131
Target Start/End: Complemental strand, 39784948 - 39784838
Alignment:
| Q |
18 |
agaatatatggagattttctctcatataaaacttgaggttggtttatttgttgggagtgaaggatattgtcctacttgttgtgctgaaacttgtacattg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| ||||| |||||||||||||||||| |||||||| |
|
|
| T |
39784948 |
agaatatatggagattttctctcatataaaacttgaggttgatttatttgttgggagagaagga---tgtcccacttgttgtgctgaaactggtacattg |
39784852 |
T |
 |
| Q |
118 |
ggttggagtaccat |
131 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
39784851 |
ggttggagtaccat |
39784838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University