View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2524_low_21 (Length: 303)
Name: NF2524_low_21
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2524_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 42 - 286
Target Start/End: Complemental strand, 29339568 - 29339324
Alignment:
| Q |
42 |
cacatttcaacaatttgttattaattattttggcaggagtatagtatatttatggatccatctcacttaggttagatagtgacatattgtcggaggtgag |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29339568 |
cacatttcaacaatttgttattaattattttggcaggagtatagtatatttatggatccatctcacttaggttagatattgacatattgtcggaggtgag |
29339469 |
T |
 |
| Q |
142 |
atgtgagagaccgatgatcttcttaatgtatgattgtgatgatgatccgcgtgctccgtgttctagatgaggttctcaattgctattgtgttggtggagc |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29339468 |
atgtgagaggccgatgatcttcttaatgtatgattgtgatgatgatccgcgtgctccgtgttctagatgaggttttcaattgctattgtgttggtggagc |
29339369 |
T |
 |
| Q |
242 |
gagcttgtcaccgtaggtctagtccggagcaagacctaatatctg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29339368 |
gagcttgtcaccgtaggtctagtccggagcaagacctaatatctg |
29339324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University