View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2524_low_24 (Length: 285)

Name: NF2524_low_24
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2524_low_24
NF2524_low_24
[»] chr4 (2 HSPs)
chr4 (19-190)||(30250714-30250885)
chr4 (242-285)||(30250620-30250663)


Alignment Details
Target: chr4 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 30250885 - 30250714
Alignment:
19 tatgttatgtggataattgttgaattccaacaaaataaaatttcatgaattattttaaacaattcaattaaccaaaccttactagaagaacctatcatat 118  Q
    |||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30250885 tatgatatgtggataattgttgaattccagcaaaataaaatttcatgaattattttaaacaattcaattaaccaaaccttactagaagaacctatcatat 30250786  T
119 ttaaactgattcacaaaaaacannnnnnnnnattcatagttaaccaaaaacagaaaaataaacgaaaatcat 190  Q
    ||||||||||||| |||||| |         |||||||||||||||||||||||||||||||||||||||||    
30250785 ttaaactgattcagaaaaaatatttttttttattcatagttaaccaaaaacagaaaaataaacgaaaatcat 30250714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 242 - 285
Target Start/End: Complemental strand, 30250663 - 30250620
Alignment:
242 aaaagttactgggattgattatcataacttttaaatttttgatt 285  Q
    ||||||||||||||||||||||||||||||||||| || |||||    
30250663 aaaagttactgggattgattatcataacttttaaagttgtgatt 30250620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University