View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2524_low_24 (Length: 285)
Name: NF2524_low_24
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2524_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 30250885 - 30250714
Alignment:
| Q |
19 |
tatgttatgtggataattgttgaattccaacaaaataaaatttcatgaattattttaaacaattcaattaaccaaaccttactagaagaacctatcatat |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30250885 |
tatgatatgtggataattgttgaattccagcaaaataaaatttcatgaattattttaaacaattcaattaaccaaaccttactagaagaacctatcatat |
30250786 |
T |
|
| Q |
119 |
ttaaactgattcacaaaaaacannnnnnnnnattcatagttaaccaaaaacagaaaaataaacgaaaatcat |
190 |
Q |
| |
|
||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30250785 |
ttaaactgattcagaaaaaatatttttttttattcatagttaaccaaaaacagaaaaataaacgaaaatcat |
30250714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 242 - 285
Target Start/End: Complemental strand, 30250663 - 30250620
Alignment:
| Q |
242 |
aaaagttactgggattgattatcataacttttaaatttttgatt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
30250663 |
aaaagttactgggattgattatcataacttttaaagttgtgatt |
30250620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University