View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2524_low_25 (Length: 282)
Name: NF2524_low_25
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2524_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 6 - 266
Target Start/End: Original strand, 49378023 - 49378283
Alignment:
| Q |
6 |
accataattaatgctctgtatgatgcatattgcttcttttgaagtggttcaattcatccatcaaactcaggaacaaaaccttgccatgctttgctttgat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49378023 |
accataattaatgctctgtatgatgcatattgcttcttttgaagtggttcaattcatccatcaaactcaggaacaaaaccttgccatgctttgctttgat |
49378122 |
T |
|
| Q |
106 |
ttctctaattagtaattgagattcgaaagtgacatcttatctatatggggtttcatcttgccagggcaaacttagacacttaaccaatttagttgtaggg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
49378123 |
ttctctaattagtaattgagattcgaaagtgacatcttatctatatggggtttcatcttgcctggccaaacttagacacttaaccaatttagttgtaggg |
49378222 |
T |
|
| Q |
206 |
gtgtgtgtgggtgaagtaatggatgataggtaaatggccaacaatgaattagacccataat |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49378223 |
gtgtgtgtgggtgaagtaatggatgataggtaaatggccaacaatgaattagacccataat |
49378283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University