View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2524_low_29 (Length: 261)
Name: NF2524_low_29
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2524_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 10 - 211
Target Start/End: Original strand, 45035449 - 45035650
Alignment:
| Q |
10 |
gcacagaacacaattgttaatacttaggagtaaattcaatcactcaaattttctggagtgttattgtcaaaagaaattattcaagagaattgaagtgtaa |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45035449 |
gcacataacacaattgttaatacttaggagtaaattcaatcactcaaattttctggagtactattgtcaaaagaaattattcgagagaattgaagtgtaa |
45035548 |
T |
 |
| Q |
110 |
gtttagaatatcatattggtcaagaatgtgctatatgaagaatagtctcgcaaacctcgtattataaccaacactgtacatcagactacttttacaactc |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45035549 |
gtttagaatatcatattggtcaggaatgtgctatatgaagaatagactcacaaacctcgtattataaccaacactgtacatcagactacttttacaactc |
45035648 |
T |
 |
| Q |
210 |
at |
211 |
Q |
| |
|
|| |
|
|
| T |
45035649 |
at |
45035650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University