View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2524_low_3 (Length: 514)
Name: NF2524_low_3
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2524_low_3 |
 |  |
|
| [»] scaffold0251 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0251 (Bit Score: 280; Significance: 1e-156; HSPs: 1)
Name: scaffold0251
Description:
Target: scaffold0251; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 92 - 497
Target Start/End: Complemental strand, 6929 - 6534
Alignment:
| Q |
92 |
atgagggtgttgtcaaacaggtggataacgagtatttcacgagcgtttggaacgatatttgggtggaagacacnnnnnnnnnnnnaggtcaaaggtttat |
191 |
Q |
| |
|
||||| |||||||||||| ||||| ||||| |||||||||||||| |||||||||||||||||||| ||| || ||||||||||||||| |
|
|
| T |
6929 |
atgagtgtgttgtcaaaccggtgggtaacgtgtatttcacgagcgcttggaacgatatttgggtggtagatactatcta------aggtcaaaggtttat |
6836 |
T |
 |
| Q |
192 |
gggcttttgttggtctatgaacaaaaatactatggttgcgcaatgttgacattgtgagtcgaacaagtctgtgtgacagtttgttaggacgaagaagttg |
291 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6835 |
aggcttttgttggtctatgaacaaaaagactttggttgcgcaatgttgacattgtgagtcgaacaagtctgtgtgactgtttgttaggacgaagaagttg |
6736 |
T |
 |
| Q |
292 |
tttgtgtgggagtaccagctattggaggagctaaagtcagttttatgcagggttaccatcaattctatttggcggttaaaagttggagttgctgggattg |
391 |
Q |
| |
|
|| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6735 |
ttcgtgtgggagtaccagttattggaggagctaaagtcagttttatgcagggttaccatcaattctatttggcggttaaaagttggagttgctgggattg |
6636 |
T |
 |
| Q |
392 |
ttctaagtaggtgttgctctgttagtttagccaataattttgattcagtacatatatatgtttggactacaggaatccaagttgaggagactaatattct |
491 |
Q |
| |
|
|||||| | ||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6635 |
ttctaaattggttttgctctgttagtttagccaataattttgtttcagtac----atatgtttggactacaggaatccaagttgaggagactaatattct |
6540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University