View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2524_low_39 (Length: 242)
Name: NF2524_low_39
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2524_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 31437553 - 31437333
Alignment:
| Q |
1 |
cctgtaaacccgaacatgtcgttctgattattgagccacatgttcttaatgccagatactgagaaagacttgggcaaatcccctgtgagattgttatatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31437553 |
cctgtaaacccgaacatgtcgttctgattattgagccacatgttcttaatgccagatactgagaaagacttgggcaaatcccctgtgagattgttatatg |
31437454 |
T |
 |
| Q |
101 |
agagccgaagctcctgcaaattgactaaagaatcaaatatatcgggcagggaaccctcgagattggtacctccaaggtcaagtgagactaggctggaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31437453 |
agagccgaagctcctgcaaattgactaaagaatcaaatatatcgggcagggaaccctcgagattggtacctccaaggtcaagtgagactaggctggaaga |
31437354 |
T |
 |
| Q |
201 |
ctcagccaagtctgttggaaa |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31437353 |
ctcagccaagtctgttggaaa |
31437333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 22 - 104
Target Start/End: Complemental strand, 15061868 - 15061786
Alignment:
| Q |
22 |
ttctgattattgagccacatgttcttaatgccagatactgagaaagacttgggcaaatcccctgtgagattgttatatgagag |
104 |
Q |
| |
|
|||||||| |||||||||| ||||| ||| |||||| | ||||||||| | ||||||||||| ||||| |||||||||||||| |
|
|
| T |
15061868 |
ttctgattgttgagccacaagttctgaataccagatcccgagaaagacattggcaaatcccccgtgaggttgttatatgagag |
15061786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University