View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2524_low_43 (Length: 222)
Name: NF2524_low_43
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2524_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 19 - 156
Target Start/End: Complemental strand, 23074800 - 23074663
Alignment:
| Q |
19 |
atgtcttctactcaaacttatccaaagattgatcttattcaatgtgtgatttgtagcaatgacttcaaagtaaaatcctacgattttgcaattatgtttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23074800 |
atgtcttctactcaaacttatccaaagatttatcttattcaatgtgtgatttgtagcaatgacttcaaagtaaaatcctaggattttgcaattatgtttg |
23074701 |
T |
|
| Q |
119 |
ccttcaatcatcatgatagttaaaattccaatttaaat |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23074700 |
ccttcaatcatcatgatagttaaaattccaatttaaat |
23074663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 130 - 184
Target Start/End: Original strand, 32429705 - 32429759
Alignment:
| Q |
130 |
catgatagttaaaattccaatttaaatggttaaatcctatgattttgcgattatg |
184 |
Q |
| |
|
|||| |||||||||||||||||| ||| || |||||| ||||||||||||||||| |
|
|
| T |
32429705 |
catggtagttaaaattccaatttgaattgtaaaatcccatgattttgcgattatg |
32429759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University