View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2524_low_8 (Length: 432)
Name: NF2524_low_8
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2524_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 8e-71; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 54 - 221
Target Start/End: Complemental strand, 1140570 - 1140404
Alignment:
| Q |
54 |
ataactgtttctttctttctaaactatttggttgtcattgattggatgcagggactacaaccaaatgaactggttttagaagaagattgcaaggatgact |
153 |
Q |
| |
|
|||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
1140570 |
ataaatgtttctttctttataa-ctatttggttgtcattgattggatgcagggactacaaccaaatgaactgattttatgagaagattgcaaggatgact |
1140472 |
T |
|
| Q |
154 |
caaactaactttcacatgtatttctcttttgatattaaaaaagaaacattcacactagagagagatgg |
221 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1140471 |
caaactaactttcacatgaatttctcttttgatattaaaaaagaaacattcacactagagagagatgg |
1140404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 220 - 325
Target Start/End: Complemental strand, 1140356 - 1140251
Alignment:
| Q |
220 |
ggaattgtacagccgtctctgttgctgcagaagccgcacagcagttgtctttgaaacgtcggcctttcacctttaaccataggcgaaaagaaaccgtcca |
319 |
Q |
| |
|
|||| |||||| || |||| |||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1140356 |
ggaaatgtacaaccatctccgttgctgcagaatccgcacagcagttgtctttgaaacgtcgacctttcacctttaaccataggcgaaaagaaaccgtcca |
1140257 |
T |
|
| Q |
320 |
ttaaat |
325 |
Q |
| |
|
|||||| |
|
|
| T |
1140256 |
ttaaat |
1140251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 327 - 426
Target Start/End: Complemental strand, 1139723 - 1139624
Alignment:
| Q |
327 |
ttcttcaattatatacgattaacaatttcaaaactggtatgaatcttcattgtcatttgggattctcttttgaattttaagatcattttattcatatcac |
426 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
1139723 |
ttcttcaattatatacgattaacaatttcaaaattgatatgaatcttcattgtcatttgagattttcttttgaattttaagattattttattcatatcac |
1139624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 44515112 - 44515056
Alignment:
| Q |
1 |
tactcatacccttagattaaatacagaatgtaactaggttcaaggaatatatgataa |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44515112 |
tactcatacccttagattaaatacagaatgtaactaggttcaaggaatatatgataa |
44515056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University