View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2524_low_9 (Length: 411)
Name: NF2524_low_9
Description: NF2524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2524_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 155 - 247
Target Start/End: Complemental strand, 4822383 - 4822291
Alignment:
| Q |
155 |
aagtgttgaatagattgtacttcaaatgagttgccatattgtgatgttatggatatgaatatgatgagaacttaccattaagaactataaaca |
247 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4822383 |
aagtgttgaatagattgtatttcaaatgagttgccatattgtgatgctatggatatgaatatgatgagaacttaccattaagaactataaaca |
4822291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 14 - 89
Target Start/End: Complemental strand, 4822524 - 4822449
Alignment:
| Q |
14 |
ttcttattgtaccagattctatgagttgtctagcactcatattattggatgttgcattgataacatgaaatcttga |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4822524 |
ttcttattgtaccagattctatgagttgtctagcactcatattattggatgttgcattgataacatgaaatcttga |
4822449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 295 - 395
Target Start/End: Complemental strand, 4822243 - 4822137
Alignment:
| Q |
295 |
atcaatctatctaagaagattcaaagacattatcctcttctggannnnnnnnctt------ttcagaattacatatttttaattccaacaaaacatatca |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4822243 |
atcaatctatctaagaagattcaaagacattatcctcttctggatttttctttttctttttttcagaattacatatttttaattccaacaaaatatatca |
4822144 |
T |
 |
| Q |
389 |
acctttt |
395 |
Q |
| |
|
||||||| |
|
|
| T |
4822143 |
acctttt |
4822137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University