View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2525_high_16 (Length: 250)
Name: NF2525_high_16
Description: NF2525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2525_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 50532119 - 50531872
Alignment:
| Q |
1 |
ttgtcgatacaaacccaggcttgtaaagtttatataacgttaaaggtgaaacaaactatgtgctgcttttaggctgtaagggtttggcaccattgacagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
50532119 |
ttgtcgatacaaacccaggcttgtaaactttatataacgttaaaggtgaaacaaactatgtgctgcttttaggttgtaagggtttggcaccattgacagt |
50532020 |
T |
 |
| Q |
101 |
tggtttgcttgaatcaatctctgccatggtttccggtcggttacggtttcaactttgaattttcacatgaagccaaccattgaaattaaacacctgggtt |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50532019 |
tggcttgcttgaatcaatctctgccatggtttccggtcggttacggtttcaactttgaattttcacatgaagccaaccattgaaattaaacacctgggtt |
50531920 |
T |
 |
| Q |
201 |
ttattcatacccttcattcaatatcctcttctcttctctgctcctcct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50531919 |
ttattcatacccttcattcaatatcctcttctcttctcttctcctcct |
50531872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 35 - 208
Target Start/End: Complemental strand, 50533790 - 50533612
Alignment:
| Q |
35 |
taacgttaaaggtgaaacaaactatgtgctg-----------cttttaggctgtaagggtttggcaccattgacagttggtttgcttgaatcaatctctg |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||| |||||| |||| || |||||||| ||||||||||| |||| |
|
|
| T |
50533790 |
taacgttaaaggtgaaacaaactatgtgctgatatacataaacttttaggttgtataggtttgtcacctttcacagttggcttgcttgaatc----tctg |
50533695 |
T |
 |
| Q |
124 |
ccatggtttccggtcggttacggtttcaactttgaattttcacatgaagccaaccattgaaattaaacacctgggttttattcat |
208 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
50533694 |
ccatggtt-ccggtcggttagggtttcacctt-gaattttcacatgaagccaaccattgaaattaaataccccggttttattcat |
50533612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University