View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2525_high_27 (Length: 204)

Name: NF2525_high_27
Description: NF2525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2525_high_27
NF2525_high_27
[»] chr5 (1 HSPs)
chr5 (12-196)||(35786975-35787159)
[»] chr7 (1 HSPs)
chr7 (73-106)||(25896641-25896674)
[»] chr3 (1 HSPs)
chr3 (73-105)||(52690554-52690586)


Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 12 - 196
Target Start/End: Complemental strand, 35787159 - 35786975
Alignment:
12 gcaaaggtaaaggtggacctgataacaacaaattcagataccgtggtgtaagacaacgtagttggggtaaatgggttgctgaaattcgtgaaccacgtaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35787159 gcaaaggtaaaggtggacctgataacaacaaattcagataccgtggtgtaagacaacgtagttggggtaaatgggttgctgaaattcgtgaaccacgtaa 35787060  T
112 acgtactcgtaaatggcttggtactttttcaactgctgaagatgctgctaaagcttatgatcgtgctgctattattctctatggt 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35787059 acgtactcgtaaatggcttggtactttttcaactgctgaagatgctgctaaagcttatgatcgtgctgctattattctctatggt 35786975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 73 - 106
Target Start/End: Complemental strand, 25896674 - 25896641
Alignment:
73 ttggggtaaatgggttgctgaaattcgtgaacca 106  Q
    ||||||||||||||||||||| ||||||||||||    
25896674 ttggggtaaatgggttgctgagattcgtgaacca 25896641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 105
Target Start/End: Original strand, 52690554 - 52690586
Alignment:
73 ttggggtaaatgggttgctgaaattcgtgaacc 105  Q
    |||||||||||||||||||||||| ||||||||    
52690554 ttggggtaaatgggttgctgaaatccgtgaacc 52690586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University