View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2525_low_13 (Length: 342)
Name: NF2525_low_13
Description: NF2525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2525_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 19 - 214
Target Start/End: Original strand, 33154210 - 33154405
Alignment:
| Q |
19 |
aatggactcattacgggtcaacaaattaggtcttgttaagaaacaagtaaaagggtttgcaattattatacaagaagaaaggactcaatgatcaaatttt |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33154210 |
aatggactcattacgggtcaacgaattaggtcttgttaagaaacaagtaaaagggtttgcaattattatacaagaagaaaggactcaatgatcaaatttt |
33154309 |
T |
|
| Q |
119 |
aattgtatgccttaggttagggtcctatgatatgatataaccaattgccatgtttgactaactaccattgatagtgagaggtgatcaaggtagggc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33154310 |
aattgtatgccttaggttagggtcctatgatatgatataaccaattgccatgtttgactaactaccattgatagtgagaggtgatcaaggtagggc |
33154405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 249 - 330
Target Start/End: Original strand, 33154440 - 33154521
Alignment:
| Q |
249 |
cggttcaataggttggaaacactcaccacttcaagattccctcccactatgattatcttttggtccttttctccttctccta |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33154440 |
cggttcaataggttggaaacactcaccacttcaagattccctcccactatgattatcttttggtccttttctccttctccta |
33154521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University