View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2525_low_14 (Length: 294)
Name: NF2525_low_14
Description: NF2525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2525_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 11 - 280
Target Start/End: Complemental strand, 28025144 - 28024878
Alignment:
| Q |
11 |
cataggttaggggctggttggtttatttatatagtttaaggatgggtttattccatcttaattacnnnnnnnccgtccattatgacattttatattatga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
28025144 |
cataggttaggggctggttggtttatttatatagtttaaggatgggtttattccatcttaattactttttttccgttcattatgacattttatattatga |
28025045 |
T |
 |
| Q |
111 |
cgaaaattgacaagttctaagacaatagattattcattttcttgggtatatcatgccaatttgttgtaaaagttttcttatcttatcacctcattttcaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28025044 |
cgaaaattgacaagttctaagacaatagattattcattttcttggg--tatcatgccaatttgttgtaaaagttttcttatcttatcacctcattttcaa |
28024947 |
T |
 |
| Q |
211 |
tatnnnnnnnntgggatagatgtattagactaacacaaaaatttaaactttgattaagttacaagttttg |
280 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28024946 |
ta-aaaaaaaatgggatagatgtattagactaacacaaaaatttaaactttgattaagttacaagttttg |
28024878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University