View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2525_low_25 (Length: 239)
Name: NF2525_low_25
Description: NF2525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2525_low_25 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 5000010 - 5000242
Alignment:
| Q |
18 |
aaattgattatcgaaaagacatacaagacctacttgatgacccaaattgactaagaaaagatgcatctatgcatgtttttataattttt-tccattcaag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5000010 |
aaattgattatcgaaaagacatacaagacctacttgatgacccaaattgactaagaaaagatgcatctatgcatgtttttataatttttatccattcaag |
5000109 |
T |
|
| Q |
117 |
gactatgtcacaatgtttcaagatactattatcacaatgttt----------cnnnnnnnnggctatagtctatagacagtactgctgctgcttctgcac |
206 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5000110 |
gactatgtcaaaatgtttcaagatactattatcacaatgtttaaaaaaaaaagaaaaaaaaggctatagtctatagacagtactgctgctgcttctgcac |
5000209 |
T |
|
| Q |
207 |
tattttggctatattgagaaaggtgagagcaat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5000210 |
tattttggctatattgagaaaggtgagagcaat |
5000242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University