View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2525_low_29 (Length: 234)
Name: NF2525_low_29
Description: NF2525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2525_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 14 - 226
Target Start/End: Original strand, 48892693 - 48892899
Alignment:
| Q |
14 |
accaccaacccattttttcacgtaaggttgctaagtcttaca--ggagataaattaaggatctaggttcaaacattagtgacacagaaaatatcaaccaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48892693 |
accaccaacccattttttcacgtaaggttgctaagtcttacacaggagataaa----ggaactaggttcaaacattagtgacacagaaaatatcaacaaa |
48892788 |
T |
 |
| Q |
112 |
ctactactagtatatatactaatatttgttttgtccaaaaaatgtgatgtaggatacgacacaaacacaccgacaccaataataaattgagaaaacgacg |
211 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48892789 |
ctactactagtata----ctaatatttgttttgtccaaaaaatgtgatgtaggatacgacacaaacacactgacaccaataataaattgagaaaacgacg |
48892884 |
T |
 |
| Q |
212 |
ttattcagtataatc |
226 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
48892885 |
taattcagtataatc |
48892899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University