View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2526_high_2 (Length: 253)
Name: NF2526_high_2
Description: NF2526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2526_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 12150515 - 12150291
Alignment:
| Q |
1 |
taataattacatgtcgttgaatcaaagaaataaatggcaactttgatataacgatcttgtagttgctacaccgtgtgttgtcgtgtagctagggttatcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12150515 |
taataattacatgtcgttgaatcaaagaaataaatgaaaattttgatataacgatcttgtagttgctacaccgtgtgttgtcgtgtagctagggttatcc |
12150416 |
T |
 |
| Q |
101 |
aaatccgaatgc-aagacttgtaaaagaaagaaatagaaagattatgtatgtagaggttaagtaagtgtattattcatttaacaggtacaatagatcata |
199 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12150415 |
aaatccgaatgcaaagacttgtaaaagaaagaaatagaaagattatgtatgta-aggttaattaagtgtattattcatttaacaggtacactagatcata |
12150317 |
T |
 |
| Q |
200 |
ggattctaacttttattgtatatgtt |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
12150316 |
ggattctaacttttattgtatatgtt |
12150291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University