View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2526_low_3 (Length: 343)
Name: NF2526_low_3
Description: NF2526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2526_low_3 |
 | |
|
| [»] scaffold0012 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0012 (Bit Score: 156; Significance: 8e-83; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 104 - 270
Target Start/End: Complemental strand, 243054 - 242887
Alignment:
| Q |
104 |
tgggctctatcaacaatttgttgcttataatcaaagtggaagatttgtttcttgtgctgtcatttgattatgaaattgttacgggaattatgggtttg-t |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
243054 |
tgggctctatcaacaatttgttgcttataatcaaagtggaagatttgtttcttgtgctgtcatttgattatgagattgttacgggaattatgggtttgtt |
242955 |
T |
|
| Q |
203 |
attggtattgttgtcatttgatttctttcagatcccaaatcttttggttttcatatcaaaggtttgat |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
242954 |
attggtattgttgtcatttgatttctttcagatcccaaatcttttggttttcatatcaaaggtttgat |
242887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 156; Significance: 8e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 104 - 270
Target Start/End: Complemental strand, 6710298 - 6710131
Alignment:
| Q |
104 |
tgggctctatcaacaatttgttgcttataatcaaagtggaagatttgtttcttgtgctgtcatttgattatgaaattgttacgggaattatgggtttg-t |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
6710298 |
tgggctctatcaacaatttgttgcttataatcaaagtggaagatttgtttcttgtgctgtcatttgattatgagattgttacgggaattatgggtttgtt |
6710199 |
T |
|
| Q |
203 |
attggtattgttgtcatttgatttctttcagatcccaaatcttttggttttcatatcaaaggtttgat |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6710198 |
attggtattgttgtcatttgatttctttcagatcccaaatcttttggttttcatatcaaaggtttgat |
6710131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 91; Significance: 5e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 104 - 235
Target Start/End: Complemental strand, 47606089 - 47605960
Alignment:
| Q |
104 |
tgggctctatcaacaatttgttgcttataatcaaagtggaagatttgtttcttgtgctgtcatttgattatgaaattgttacgggaattatgggtttg-t |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| | |||||||||||||||||||| | |
|
|
| T |
47606089 |
tgggctctatcaacaatttgttgcttataatcaaagtggaagatttgtttcttgtgttttcatttgattatg---tgattacgggaattatgggtttgtt |
47605993 |
T |
|
| Q |
203 |
attggtattgttgtcatttgatttctttcagat |
235 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
47605992 |
attggtattgttgtcatttgattcctttcagat |
47605960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University