View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2527_low_7 (Length: 311)
Name: NF2527_low_7
Description: NF2527
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2527_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 16 - 303
Target Start/End: Original strand, 414253 - 414546
Alignment:
| Q |
16 |
attaattataattatcccataaataaatgctctcaattcgtttcattacatcattctctcatttcgatttcaaatctcactttcttctcttttct----- |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
414253 |
attaattataattatcccataaataaatgctctcaattcgtttcattacatcattctctcatttcaatttcaaatctcactttcttctcttttcttcttc |
414352 |
T |
|
| Q |
111 |
-tccgccgcaaccatgtcatccaccaccgcaaccaacgccgtctccgccacagatgatgcgaaacacggtttctctcgtcctgagatgtacaaagaaaac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
414353 |
ttccgccgcaaccatgtcatccaccaccgcaaccgacgccgtctccgccacagatgatgcgaaacacggtttctctcgtcctgagatgtacaaagaaaac |
414452 |
T |
|
| Q |
210 |
ctcgctggaaccgtagcttcttacgatcgtcacgtttttctctgttacaagaatcgtcaaacttggcctccgcgtcttgaagcttctgatgatg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
414453 |
ctcgctggaaccgtagcttcttacgatcgtcacgtttttctctgttacaagaatcgtcaaacttggcctccgcgtcttgaagcttctgatgatg |
414546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 178 - 301
Target Start/End: Complemental strand, 401202 - 401079
Alignment:
| Q |
178 |
gtttctctcgtcctgagatgtacaaagaaaacctcgctggaaccgtagcttcttacgatcgtcacgtttttctctgttacaagaatcgtcaaacttggcc |
277 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||| |||||||| || | || ||||||||||| || ||||| ||||||||||| | ||||||||||| |
|
|
| T |
401202 |
gtttctcccgttatgagatgtacaagcaaaaccttgctggaacagttgaatcctacgatcgtcatgtctttctatgttacaagaaccaccaaacttggcc |
401103 |
T |
|
| Q |
278 |
tccgcgtcttgaagcttctgatga |
301 |
Q |
| |
|
|||| || ||||||| || ||||| |
|
|
| T |
401102 |
tccgtgtgttgaagcctccgatga |
401079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University