View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2528_high_6 (Length: 238)
Name: NF2528_high_6
Description: NF2528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2528_high_6 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 2562974 - 2562753
Alignment:
| Q |
18 |
acataaggtaagttattttagtatctttatttattggcaatattttctattttaacttgctagaaaaaaggttggtatgaatcattgtaatgaagataa- |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2562974 |
acataaggtaagttattttagtatctttatttattggcaatattttctattttaacttgctagaaaggaggttggtatgaatcattgtaatgaagataaa |
2562875 |
T |
|
| Q |
117 |
gatgaaatgcttgttatgttgcatttttggaaattatgaaattattttggtattttcgttgtttccaaaaattgcacataattgctcacttttaagtgtc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2562874 |
gatgaaatgcttgttatgttgcatttttggaaattatgaaattattttggtattttagttgtttccaagaattgcacataattgctcacttttaagtgtc |
2562775 |
T |
|
| Q |
217 |
tagcacttccttggtaacaagt |
238 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
2562774 |
tagcacttccttggtagcaagt |
2562753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 194
Target Start/End: Original strand, 24370502 - 24370540
Alignment:
| Q |
156 |
aattattttggtattttcgttgtttccaaaaattgcaca |
194 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
24370502 |
aattattttggtattttcattgtttccaaaaaatgcaca |
24370540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University