View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2529_high_5 (Length: 380)
Name: NF2529_high_5
Description: NF2529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2529_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 5 - 160
Target Start/End: Complemental strand, 24313312 - 24313157
Alignment:
| Q |
5 |
aaaaggggtagatctttgaatcgcagcaagtccagttctggcaccaagtcccttgactttgaatctgtaatacatgcaacatgttaaatagtcattcgtg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24313312 |
aaaaggggtagatctttgaatcgcagcaagtccagttctggcaccaagtcccttgactttgaatctgtaatacatgcaatatgttaaatagtcattcgtg |
24313213 |
T |
 |
| Q |
105 |
taaaaataaataaataattcaacaattaatttattattatgatacgtgtgaagtta |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |||||| |||||||||||| |
|
|
| T |
24313212 |
taaaaataaataaataattcaacaattaattaattactatgattcgtgtgaagtta |
24313157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 166 - 255
Target Start/End: Complemental strand, 24313028 - 24312939
Alignment:
| Q |
166 |
tttatggttatgatatcattttcttgagcgtgaatgtgaacagaaaaaagccacttcaagctaattaaacatgaggaatctttcgggagg |
255 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
24313028 |
tttatggttatggtatcattttcttgagcgtgaatgtgaacagaaaaaagctacttcaaggtcattaaacatgaggaatctttcgggagg |
24312939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University