View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2529_high_8 (Length: 314)
Name: NF2529_high_8
Description: NF2529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2529_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 24313292 - 24313576
Alignment:
| Q |
1 |
attcaaagatctaccccttttcaatttgaaaaatcaacatgattttctacaaagcatagctaaaacactttcaataacacctttgggtgttatattcaac |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||| |||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24313292 |
attcaaagatctacccctttttaatttgacaaatcaatatgattttttacaaagcataggtaaaacactttcaataacacctttgggtgttatattcaac |
24313391 |
T |
|
| Q |
101 |
accgtggaaagcttagaagattcatcactaaatcaactccaaaagctatacaaagttaacctcttccccataggtcctctacacatgattgccaatgatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24313392 |
accgtggaaagcttagaagattcatcactaaatcaactccaaaagctatacaaagctaacctcttccccataggtcctctacacatgattgccaatgatg |
24313491 |
T |
|
| Q |
201 |
ccagcaatactaatagcattctgcaagaaaatgataattgcatatcttggctaa---acaacaaagcaagaaaatctgtgttatatgt |
285 |
Q |
| |
|
| | ||| || ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||||||| |
|
|
| T |
24313492 |
ctaacaa---tagtagcattctgcaagaaaatgataattgcatatcttggctaaattacaacaaaccaagaaagtctgtgttatatgt |
24313576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University