View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2529_high_9 (Length: 259)
Name: NF2529_high_9
Description: NF2529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2529_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 2394449 - 2394220
Alignment:
| Q |
1 |
aacgtgatttcatttttgggatacatgggtctttaaaggaaatggaacttatgccatatcttgttgaaatttatgtttgtaggttttgagatgttcggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2394449 |
aacgtgatttcatttttgggatacatggatctttaaaggaaatggaacttatgccatatcttgttgaaatttatgtttgtaggttttgagatgttcgcaa |
2394350 |
T |
|
| Q |
101 |
attccggctgattaagcagctcatcttatgagggaaaaacatgctagtatttnnnnnnnnnnnnccatattgtttgtactttgcagtaacaaaacaccat |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2394349 |
attccggctgattaaggagctcatcttatgagggaaaaacatgctagtatttaaaaaaaaaaaaccatagtgtttgtactttgcagtaacaaaacaccat |
2394250 |
T |
|
| Q |
201 |
tnnnnnnnccatagtatttgcaggaacaat |
230 |
Q |
| |
|
| |||||||||||||||||||||| |
|
|
| T |
2394249 |
taaaaaaaccatagtatttgcaggaacaat |
2394220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 141
Target Start/End: Original strand, 32339553 - 32339651
Alignment:
| Q |
43 |
tggaacttatgccatatcttgttgaaatttatgtttgtaggttttgagatgttcggaaattccggctgattaagcagctcatcttatgagggaaaaaca |
141 |
Q |
| |
|
|||||||| || || ||| | ||||||||||| ||||||||||||||||| | |||| || |||||| || ||||||||||||||||||||||| |
|
|
| T |
32339553 |
tggaacttctgtcacatcctattgaaatttatccttgtaggttttgagatgggagcaaatccctgctgataaacgtgctcatcttatgagggaaaaaca |
32339651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University