View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2530_low_7 (Length: 415)
Name: NF2530_low_7
Description: NF2530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2530_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 18 - 399
Target Start/End: Complemental strand, 45108076 - 45107689
Alignment:
| Q |
18 |
gaattaaggtaattgtaatcaatt--ttgtg---tg-gttattatttgtgtgtaggctgggctaattttaggaccagcagtgccaatatttttggacctc |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||||| || ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45108076 |
gaattaaggtaattgtaatcaattgattgtgcattgtgttgttatttttgtgtaggctgggctaattttaggaccagcagtgccaatatttttggacctc |
45107977 |
T |
 |
| Q |
112 |
aagatgaatttgtttccttatgggagtcaagacacacttgcaaccattgcaggacttggctatgtgttgtttctgttcgaaacaggcgtgaaaatggatt |
211 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45107976 |
aagaggaatttgtttccttatgggagtcaagacacacttgcaaccattgcaggacttggttatgtgttgtttctgttcgaaacaggcgtgaaaatggatt |
45107877 |
T |
 |
| Q |
212 |
tcaacatgatcagaaggacaggaagaaaaggatggacgatttcacttttggggttagtaacccctatgctcattggtttatgtttctctatctgggatcc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45107876 |
tcaacatgatcagaaggacaggaagaaaaggatggacgatttcgcttttggggttagtaacccctatgctcattggtttatgtttctctatctgggatcc |
45107777 |
T |
 |
| Q |
312 |
aaaacatagaaatgtttttaacaaagagtccattgaaaaaggtataatactgctaggacacaatacaacttcatttgcagtgattgtg |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45107776 |
aaaacatagaaatgtttttaacaaagagtccattgaaaaaggtataatactgctaggacacaatacaacttcatttgcagtgattgtg |
45107689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University