View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2530_low_8 (Length: 261)

Name: NF2530_low_8
Description: NF2530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2530_low_8
NF2530_low_8
[»] chr4 (1 HSPs)
chr4 (91-246)||(43839598-43839753)


Alignment Details
Target: chr4 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 91 - 246
Target Start/End: Original strand, 43839598 - 43839753
Alignment:
91 ccaacatccaaaggaaccttgaactgtgcaatctcttccggatttttaacaaactgattcaaccggcggcgaagagtggacaaaagtggctgggattgaa 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43839598 ccaacatccaaaggaaccttgaactgtgcaatctcttccggatttttaacaaactgattcaaccggcggcgaagagtggacaaaagtggctgggattgaa 43839697  T
191 gatcaatttgatgccaaatctgctcagcatcgtaaccatcaacgagaagctcatcc 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43839698 gatcaatttgatgccaaatctgctcagcatcgtaaccatcaacgagaagctcatcc 43839753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University