View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2531_low_4 (Length: 233)
Name: NF2531_low_4
Description: NF2531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2531_low_4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 23 - 233
Target Start/End: Complemental strand, 7737642 - 7737432
Alignment:
| Q |
23 |
taggtgagaaacaaaataatctgagattgtgttttgctgcaatccctattatctttgaagtaatattatgtgatactgtcgaaggtttgataatgtgaaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7737642 |
taggtgagaaacaaaataatctgagattgtgttttgctgcaatccctattatctttgaagtaatattatgtgatactgtcaaaggtttgataatgtgaaa |
7737543 |
T |
|
| Q |
123 |
caaatattctgagattgtgttttactgcaatccctattccttcaaacaaaatatacccatcgaaacaaacaaattcgtcaaaatgtgtaactcctagtct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7737542 |
caaatattctgagattgtgttttactgcaatccctattccttcaaacaaaatatacccatcgaaacaaacaaattcgtcaaaatgtgtaactcctagtct |
7737443 |
T |
|
| Q |
223 |
caatttctctg |
233 |
Q |
| |
|
||||| |||| |
|
|
| T |
7737442 |
gaatttttctg |
7737432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University