View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2532_high_31 (Length: 251)
Name: NF2532_high_31
Description: NF2532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2532_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 98 - 224
Target Start/End: Complemental strand, 25578324 - 25578198
Alignment:
| Q |
98 |
ttgattcaaattatataaatcaaaacagtattttactcattcagtttatagaatctaaacctggccaatgtattgatgcccgtactaagaaaaaatgtgt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || || |||||||||||||||| |||||||||||||||||| |
|
|
| T |
25578324 |
ttgattcaaattatataaatcaaaacagtattttactcgttcagtttatagaatctgaaacttatcaatgtattgatgcccatactaagaaaaaatgtgt |
25578225 |
T |
 |
| Q |
198 |
ggataaggggtttggtacgattcaaat |
224 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
25578224 |
ggataaggggtttggtacaattcaaat |
25578198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University