View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2532_high_37 (Length: 242)
Name: NF2532_high_37
Description: NF2532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2532_high_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 33 - 143
Target Start/End: Complemental strand, 36530876 - 36530766
Alignment:
| Q |
33 |
attgcaatttttgtttgtgcaatttcttgatttggattaaggttgtttagctgctggtttatgcttgctttgtggtggcaatgaatggttttctagagtt |
132 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||| || ||||||||||||| ||| |||||| ||||||| ||||||||||||| |
|
|
| T |
36530876 |
attgaaatttttgtttgtgcagtttcttgatttggattaaggttgtttagttgttggtttatgcttgatttttggtggtaatgaattgttttctagagtt |
36530777 |
T |
 |
| Q |
133 |
gtaaacttgta |
143 |
Q |
| |
|
||||||||||| |
|
|
| T |
36530776 |
gtaaacttgta |
36530766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 160 - 227
Target Start/End: Complemental strand, 36530626 - 36530559
Alignment:
| Q |
160 |
actattatttaaaagcaaataatagttaattgtcgttgggatattttcatccattcgaggtacctatg |
227 |
Q |
| |
|
||||||||||| ||||||| |||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36530626 |
actattatttagaagcaaacaatagttaatcgtcgttgggatattttcatcaattcgaggtacctatg |
36530559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 51 - 136
Target Start/End: Complemental strand, 25637878 - 25637794
Alignment:
| Q |
51 |
gcaatttcttgatttggattaaggttgtttagctgctggtttatgcttgctttgtggtggcaatgaatggttttctagagttgtaa |
136 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| |||||||||||| |||||||| ||||||||||| |||||| |||||||||| |
|
|
| T |
25637878 |
gcaatttcttgatttgggtta-ggttgtttagttgctggtttatgtttgctttgcaatggcaatgaattgttttcaagagttgtaa |
25637794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 198
Target Start/End: Original strand, 36774463 - 36774503
Alignment:
| Q |
158 |
taactattatttaaaagcaaataatagttaattgtcgttgg |
198 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
36774463 |
taactattgtttaaaaggaaataatagttaatcgtcgttgg |
36774503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University