View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2532_high_39 (Length: 239)

Name: NF2532_high_39
Description: NF2532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2532_high_39
NF2532_high_39
[»] chr7 (1 HSPs)
chr7 (12-158)||(24195372-24195518)


Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 12 - 158
Target Start/End: Original strand, 24195372 - 24195518
Alignment:
12 ataggaccacggaataattctggatttatgatgggtaggaaaaacggtggtggtatgtggaggttgatggtggtttcctatgtatgaagaaaggtatttg 111  Q
    |||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
24195372 ataggaccacggaataattctgaatttatgatgggtaggaaaagcggtggtggtatgtggaggttgatggtggtttcctatgtatgaagaaaggtattag 24195471  T
112 ggtggggatgctacggtactaaatttgcctaaaattttgccataaca 158  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||    
24195472 ggtggggatgctacggtgctaaatttgcctaaaattttgccataaca 24195518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University