View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2532_high_46 (Length: 208)
Name: NF2532_high_46
Description: NF2532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2532_high_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 190
Target Start/End: Complemental strand, 24069162 - 24068991
Alignment:
| Q |
19 |
gtaccgttaaggccgtttaattatacaggaacacctccaaacaatactttggttagtaatggaacaaagacagtggtgataccatataacactagagttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24069162 |
gtaccgttaaggccgtttaattatacaggaacacctccaaacaatactttggttagtaatggaacaaagacagtggtgataccatataacactagagttc |
24069063 |
T |
 |
| Q |
119 |
aggttatattgcaggatacaagcattttgggagctgagagtcatcctttgcatcttcatggatttaatttct |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24069062 |
aggttatattgcaggatacaagcattttgggagctgagagtcatcctttgcatcttcatggatttaatttct |
24068991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 125 - 190
Target Start/End: Complemental strand, 22635537 - 22635472
Alignment:
| Q |
125 |
tattgcaggatacaagcattttgggagctgagagtcatcctttgcatcttcatggatttaatttct |
190 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
22635537 |
tattgcaggatacaagtattcttggagctgagagtcatccattgcatcttcatggttttaacttct |
22635472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University