View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2532_high_5 (Length: 491)
Name: NF2532_high_5
Description: NF2532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2532_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 283
Target Start/End: Original strand, 10131427 - 10131701
Alignment:
| Q |
1 |
ggtggcgttgaagaatccaaaagagtgaatttcttttttgaggttttgagcttgggaggttgccgccgggaagaggagaagaatgccgatgagggcggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10131427 |
ggtggcgttgaagaatccaaaagagtgagtttcttttttgaggttttgagcttgggaggttgctgccgggaagaggagaagaatgccgatgagggcggtg |
10131526 |
T |
 |
| Q |
101 |
aggtaagccatgtcggacttgtgccggcggcgacactgaatggaaagcattgttgtttgaaatgaaatgaatggtggtgttgttgattatggatacttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10131527 |
aggtaagccatgtcggacttgtgccggcggcgacactgaatggaaagcattgttgtt-----tgaaatgaatggtggtgttgttgattatggatacttat |
10131621 |
T |
 |
| Q |
201 |
tataatggtggttagttgctcttttgataattttctttgtttaaggaaaagcaggttttgaaggtgattttaataaggtgcaa |
283 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10131622 |
tataa---tggttagttgctcttttgataattttctttgtttaaggaaaagcaggttttgaaggtgattttaataaggtgcaa |
10131701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 344 - 475
Target Start/End: Original strand, 10131762 - 10131893
Alignment:
| Q |
344 |
ctaggtaagaatattattttaagaggataatacaggttgacatgtgcagggaatggacattttaaaagacaaaatcaaatgtcgtaaatgatctacagct |
443 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
10131762 |
ctaggtaagaatattattttaagaggataatacaggttgacatgtgcagggaatggacattttaaaaaacaaaatcaaatgtggtaaatgatctacagct |
10131861 |
T |
 |
| Q |
444 |
gagtaataacgtccttttaggaagtgttttgg |
475 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |
|
|
| T |
10131862 |
gagtaataacgtccctttaggaagtgttttgg |
10131893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 36 - 108
Target Start/End: Complemental strand, 50885926 - 50885854
Alignment:
| Q |
36 |
ttttgaggttttgagcttgggaggttgccgccgggaagaggagaagaatgccgatgagggcggtgaggtaagc |
108 |
Q |
| |
|
|||| |||||||||| | |||| ||| || |||||||||| |||||||||| ||||| |||||||||||||| |
|
|
| T |
50885926 |
ttttaaggttttgagatggggatattgtcgtcgggaagaggggaagaatgccaatgagagcggtgaggtaagc |
50885854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University