View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2532_low_35 (Length: 248)
Name: NF2532_low_35
Description: NF2532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2532_low_35 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 8 - 248
Target Start/End: Complemental strand, 20111997 - 20111759
Alignment:
| Q |
8 |
ataatactttaagataattaaatttgtttattaatttcccatacaccatcacctagcagcgagtccctaacaatctctctaggttctaatatatattaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20111997 |
ataatactttaagataattaaatttgtttattaatttcccatacaccatcacctaggagcgagtccctaacaatctctctaggttctaatatat--taat |
20111900 |
T |
 |
| Q |
108 |
ccaacaaatgcaaacctatgttatttgcacatgttgttctagtcctagtgctgtgtttgaaatggtggttcggacactatgaatgaatgagtttcactat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
20111899 |
ccaacaaatgcaaacctatgttatttgcacatgttgttctagtcctagtgctgtgttagaaatggtggttcggacactataaatgaatgattttcactat |
20111800 |
T |
 |
| Q |
208 |
tttagattcgttgtagatggtgtatagatcaatccaatcat |
248 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20111799 |
tttagattcgctgtagatggtgtatagatcaatccaatcat |
20111759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University