View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2532_low_38 (Length: 242)
Name: NF2532_low_38
Description: NF2532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2532_low_38 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 64 - 242
Target Start/End: Complemental strand, 368028 - 367845
Alignment:
| Q |
64 |
gttacttaccatatttgtatggttctgttttgttgt-----tttggtcttgctctctagctcttaagtttgtaatggtttaagtaccccttgtactctct |
158 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| | |||||| ||||| |||| ||||||| ||||||||||||| ||||||||||||||||| | |
|
|
| T |
368028 |
gttacttggcatatttgtatggttctgttttgttttgttattttggtgttgctttctacctcttaactttgtaatggtttgagtaccccttgtactctat |
367929 |
T |
|
| Q |
159 |
ttttcttaagtttgataatttttactatgtgaatgaaattttggaaaatatgtagtacaaatagagtattgctcaagtgtggtt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
367928 |
ttttcttaagtttgataatttttactatgtgaatgaaattctggtaaatatgtaggacaaatagagtattgctcaagtgtggtt |
367845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 169 - 242
Target Start/End: Original strand, 6738370 - 6738442
Alignment:
| Q |
169 |
tttgataatttttactatgtgaatgaaattttggaaaatatgtagtacaaatagagtattgctcaagtgtggtt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6738370 |
tttgataatttttactatgtgaatgaaattctggaaaat-tgtagtacaaatagagtattgctcaagtgtggtt |
6738442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University