View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2532_low_46 (Length: 220)
Name: NF2532_low_46
Description: NF2532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2532_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 41934714 - 41934530
Alignment:
| Q |
18 |
atctccaacccattctggaaatcgcgtgcccctgtatccatctatacctagcttttccaggtacttggcaggctgtaacttgcacagtatatccatctca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41934714 |
atctccaacccattctggaaatcgcgtgcccctgtatccatctatacctagcttttccaggtacttggcaggctgtaacttgcacagtatatccatctca |
41934615 |
T |
|
| Q |
118 |
ctttgcgaatctgtaaaattattcattgcatctagagaccatgacaatagtaatttctcaaggtgcttgtccattatctttgcct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41934614 |
ctttgcgaatctgtaaaattattcattgcatctagagaccatgacaatagtaatttctcaaggtgcttgtccattatctttgcct |
41934530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 4313215 - 4313402
Alignment:
| Q |
18 |
atctccaacccattctggaaatcgcgtgcccctgtatccatctatacctagcttttccaggtacttggcaggctgtaacttgcacagtatatccatctca |
117 |
Q |
| |
|
|||||||||||||| |||||||| ||||| | ||||||| |||| | ||| ||| || ||||||| | || |||||||||| ||||||||||||||| |
|
|
| T |
4313215 |
atctccaacccattttggaaatcttgtgccaatatatccatttatatcaagcattttcaagtacttgacgggttgtaacttgccaagtatatccatctca |
4313314 |
T |
|
| Q |
118 |
ctttgcgaatctgtaaaattattcattgcatctagagaccatgacaatagtaatttctcaagg---tgcttgtccattatctttgcct |
202 |
Q |
| |
|
||||||||||||||||||| || || ||||| ||||||||||||||| |||| |||||||| | ||| |||||||||||||||| |
|
|
| T |
4313315 |
ctttgcgaatctgtaaaatgatcatttacatcttgagaccatgacaataataatctctcaaggtacttcttatccattatctttgcct |
4313402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 81 - 136
Target Start/End: Complemental strand, 4255206 - 4255151
Alignment:
| Q |
81 |
cttggcaggctgtaacttgcacagtatatccatctcactttgcgaatctgtaaaat |
136 |
Q |
| |
|
||||| ||||||||| ||||| ||||||||||| |||||||| |||| |||||||| |
|
|
| T |
4255206 |
cttggaaggctgtaatttgcaaagtatatccatttcactttgtgaatttgtaaaat |
4255151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University