View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2533_high_7 (Length: 276)
Name: NF2533_high_7
Description: NF2533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2533_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 37645167 - 37644912
Alignment:
| Q |
1 |
tttatcttcacataacccatatgggaagaagaaaatccaaacaaagtgggataacaaaatccaaacaaactctcatcttcttttttgctcaaattggagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||| |
|
|
| T |
37645167 |
tttatcttcacataacccatatgggaagaagaaaatccaaacaaagtgggataacaaaatccaaacaaactctcttcttcttttttgctaagattggagc |
37645068 |
T |
|
| Q |
101 |
agtacatctaaaaattgaaaccttgttgatgattttgtttctttcagatctatgttttgtttgactgattttaaatgatgtgttttctgggttctgatgt |
200 |
Q |
| |
|
| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37645067 |
aatacatctgaaaattgaaaccttgttgatgattttgtttctttcagatctatgttttgtttgactgattttaaatgatgtgttttctgggttctgatgg |
37644968 |
T |
|
| Q |
201 |
gaggacgatgggacacagttgcaagaatgatggcagtgtcagatctgaagcagcga |
256 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
37644967 |
gaggacgatgggacacaattgcaagaatgatggtagtgtcagatctgaagcggcga |
37644912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University