View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2533_low_8 (Length: 276)

Name: NF2533_low_8
Description: NF2533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2533_low_8
NF2533_low_8
[»] chr1 (1 HSPs)
chr1 (1-256)||(37644912-37645167)


Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 37645167 - 37644912
Alignment:
1 tttatcttcacataacccatatgggaagaagaaaatccaaacaaagtgggataacaaaatccaaacaaactctcatcttcttttttgctcaaattggagc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | ||||||||    
37645167 tttatcttcacataacccatatgggaagaagaaaatccaaacaaagtgggataacaaaatccaaacaaactctcttcttcttttttgctaagattggagc 37645068  T
101 agtacatctaaaaattgaaaccttgttgatgattttgtttctttcagatctatgttttgtttgactgattttaaatgatgtgttttctgggttctgatgt 200  Q
    | ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
37645067 aatacatctgaaaattgaaaccttgttgatgattttgtttctttcagatctatgttttgtttgactgattttaaatgatgtgttttctgggttctgatgg 37644968  T
201 gaggacgatgggacacagttgcaagaatgatggcagtgtcagatctgaagcagcga 256  Q
    ||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||    
37644967 gaggacgatgggacacaattgcaagaatgatggtagtgtcagatctgaagcggcga 37644912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University