View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2534_high_16 (Length: 268)
Name: NF2534_high_16
Description: NF2534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2534_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 19 - 129
Target Start/End: Original strand, 38536897 - 38537007
Alignment:
| Q |
19 |
gcgacaggcatggagaagctccgtgagggacgagattagagagacgtcttagttttgactgagcttccttagtcggcagccgtcgtgtgtgtctgtaagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38536897 |
gcgacaggcatggagaagctccgtgagggacgagattagagagacgtcttagttttgactgagcttccttagtcggcagccgtcgtgtgtgtctgtaagc |
38536996 |
T |
|
| Q |
119 |
atctccttcac |
129 |
Q |
| |
|
||||||||||| |
|
|
| T |
38536997 |
atctccttcac |
38537007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 191 - 258
Target Start/End: Original strand, 38537058 - 38537125
Alignment:
| Q |
191 |
accatgtccaatttcataggaacaannnnnnnnnnattattaattctatgatttatactcttcctttg |
258 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
38537058 |
accatgtccaatttcataggaaccatttttttattattattaattctatgatttatactcttcctttg |
38537125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University