View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2534_high_20 (Length: 243)
Name: NF2534_high_20
Description: NF2534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2534_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 5604248 - 5604481
Alignment:
| Q |
1 |
ctgcttatttcagcttaattcttgtgacgatattacatcattgttaagcacttgaagttaagtttaagtggatattaactagtaacatcaataaagttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5604248 |
ctgcttatttcagcttaattcttgtgacgatattacatcattgttaagcacttgaagttaagtttaagtggatattaactagtaacatcaataaagttca |
5604347 |
T |
 |
| Q |
101 |
atactgtttatgctaggtatgagattgaaactggcgacacacccctcaagatcgtaccaaactagaaaacgaaatagcattatggctatg----tgtgag |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5604348 |
atactgtttatgctaggtatgagattgaaacaggcgacacacccctcaagatcttaccaaactagaaaacgaaatagcattatggctatgtacctgtgag |
5604447 |
T |
 |
| Q |
197 |
aagtggttgtcttgcatgcataaaactttgtatt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
5604448 |
aagtggttgtcttgcatgcataaaactttttatt |
5604481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University