View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2535_high_19 (Length: 235)
Name: NF2535_high_19
Description: NF2535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2535_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 39893055 - 39892853
Alignment:
| Q |
13 |
ggagcagagaaggcatggttattgagtgcttgttgaatgagattttgaagctcttggagtgagttgttttcattgtttggaatattatcagaaggtttgt |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39893055 |
ggagcagagaaggcatggttattgaatgcttgttgaatgagattttgaagctcttggagtgagttgttttcattgtttggaatattatcagaaggtttgt |
39892956 |
T |
 |
| Q |
113 |
tgaaagtttgttcttgttcggtattaggtttggagagatgagattgaagagtgacagggttgtttatcttctgaggttgagggtgtgaatctaagggttg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
39892955 |
tgaaagtttgttcttgttcggtattaggtttggagagatgagattgaagagtgacagggttgtttttcttctgaggttgagggtgtgaatataagggttg |
39892856 |
T |
 |
| Q |
213 |
tgg |
215 |
Q |
| |
|
||| |
|
|
| T |
39892855 |
tgg |
39892853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University