View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2535_low_20 (Length: 236)
Name: NF2535_low_20
Description: NF2535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2535_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 15824649 - 15824870
Alignment:
| Q |
1 |
tataattgtaatatta-taaaaagtgannnnnnncttataatactgaccggaggaagtatataagtagctgtgcagggcaaccgttaatattcaccattc |
99 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||| ||||| |||| ||||||||| ||||||||| |||||||||||||||||||| ||| |
|
|
| T |
15824649 |
tataattgtaatattactaaaaagtgatttttttcttataatattgacccgagggagtatataaatagctgtgctgggcaaccgttaatattcacttttc |
15824748 |
T |
|
| Q |
100 |
ctatgtgtgacgggtgctgggctctacagtgttattaattctcatgtaagcgatcaacttgatctatgtattatgtactatgttcttagtatttgtcttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15824749 |
ctatgtgtgacgggtgctgggctctatagtgtcgttaattatcatgtaagcgatcaacttgatctatgtattatgtactatgttcttagtatttgtcttg |
15824848 |
T |
|
| Q |
200 |
attttaataactaagcattttt |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
15824849 |
attttaataactaagcattttt |
15824870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University