View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2536_high_10 (Length: 209)

Name: NF2536_high_10
Description: NF2536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2536_high_10
NF2536_high_10
[»] chr7 (1 HSPs)
chr7 (30-107)||(8909580-8909657)


Alignment Details
Target: chr7 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 30 - 107
Target Start/End: Complemental strand, 8909657 - 8909580
Alignment:
30 aataaacagtaaaattagctccnnnnnnncttcttccaatatgctttttgtctttacataggaaggaaaccttaaatt 107  Q
    ||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||    
8909657 aataaacagtaaaattagctcctttttttcttcttccaatatgctttttgtctttacataggaaggaaaccttaaatt 8909580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University