View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2536_low_10 (Length: 209)
Name: NF2536_low_10
Description: NF2536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2536_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 30 - 107
Target Start/End: Complemental strand, 8909657 - 8909580
Alignment:
| Q |
30 |
aataaacagtaaaattagctccnnnnnnncttcttccaatatgctttttgtctttacataggaaggaaaccttaaatt |
107 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8909657 |
aataaacagtaaaattagctcctttttttcttcttccaatatgctttttgtctttacataggaaggaaaccttaaatt |
8909580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University