View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2536_low_9 (Length: 239)
Name: NF2536_low_9
Description: NF2536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2536_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 35446254 - 35446470
Alignment:
| Q |
1 |
gagacggcgggtgtaggcgatggaaccggcggcggaggagagagtgaggagtttggtgagaagggcacgactacggtgacgaccggagacaatgagatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35446254 |
gagacggcgggtgtaggcgatggaaccggcggcggaggagagagtgaggagtttggtgaggagggcacgactacggtgacgacctgagacaatgagatga |
35446353 |
T |
|
| Q |
101 |
gcatgagcttgttggagaggtcgaatgtgtgggccagcacgtatcactgcttcgtattctacagattttgatctttgtctttgtttttgctcttcccgcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35446354 |
gcatgagcttgttggagaggtcgaatgtgtgggccagcacgtatcactgcttcgtattctacagattttgatctttgtctttgtttttgctcttcccgcc |
35446453 |
T |
|
| Q |
201 |
cgttgtattcttccatt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35446454 |
cgttgtattcttccatt |
35446470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University