View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2538_high_5 (Length: 332)
Name: NF2538_high_5
Description: NF2538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2538_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 112 - 319
Target Start/End: Complemental strand, 32191530 - 32191323
Alignment:
| Q |
112 |
aaacccaaatttaaactttgtgatgcctagctcgacttggcatattttcattcttttaacaggtgaagttattatcaacatgtcatcacatacatatctt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32191530 |
aaacccaaatttaaactttgtgatgcctagctcgacttcgcatattttcattcttttaacaggtgaagttattatcaacatgtcatcacatacatatctt |
32191431 |
T |
 |
| Q |
212 |
tctctcgatttcagcatcaaactaggaagaagccataagtaataaataaccataagctatgtctcatgaagttgttcacgttgtttgtcagcaaacaaga |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32191430 |
tctctcgatttcagcatcaaactaggaagaagccataagtaataaataaccataagctatgtctcatgaagttgttcacgttgtttgtcagcaaacaaga |
32191331 |
T |
 |
| Q |
312 |
aatgagaa |
319 |
Q |
| |
|
|||||||| |
|
|
| T |
32191330 |
aatgagaa |
32191323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University