View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2538_high_6 (Length: 325)
Name: NF2538_high_6
Description: NF2538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2538_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 21 - 313
Target Start/End: Complemental strand, 36291882 - 36291590
Alignment:
| Q |
21 |
gtcttttcactgttggatccatcaatcacatcatatatcatttaatttaatgatgagatattgatctaattggtaaatactagcctatgcatgatgcacg |
120 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36291882 |
gtcttttcactgttggatcaataaatcacatcatatatcatttaatttaatgatgagatattgatctaattggtaaatactagcctatgcatgatgcatg |
36291783 |
T |
 |
| Q |
121 |
actcgtttcagttgttcacaatagaatggccaacaaattattccttgagagacatatatttcatagacaaataagtccataaattggtagcattgacgct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36291782 |
actcgtttcagttgttcacaatagaatggccaacaaattattccttgagagacatatatttcatagacaaattagtccataaattggtagcattgacgct |
36291683 |
T |
 |
| Q |
221 |
tgatcaacatgaaaatgctgtatatttgattaatgtgtcgcattataatctctaataggaaaagctaacaaataaactattttaactaatatt |
313 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36291682 |
tgatcaacatgaaaaggctgtatatttgattaatgtgtcacgttataatctctaataggaaaagctaacaaataaactattttaactaatatt |
36291590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 46 - 79
Target Start/End: Original strand, 8260948 - 8260981
Alignment:
| Q |
46 |
tcacatcatatatcatttaatttaatgatgagat |
79 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
8260948 |
tcacatcatatatcatttaatttaatgttgagat |
8260981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University