View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2538_low_27 (Length: 251)
Name: NF2538_low_27
Description: NF2538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2538_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 106 - 211
Target Start/End: Complemental strand, 13751415 - 13751310
Alignment:
| Q |
106 |
catcatggattccatgtcttctcttccctatcttttcatagatagatagagtaaaagaagaacaaacacgctttgcatgtttttgactctcacacgttat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13751415 |
catcatggattccatgtcttctcttccctatcttttcatagatagatagagtaaaagaagaacaaacacgctttgcatgtttttgactctcacacgttat |
13751316 |
T |
|
| Q |
206 |
agttaa |
211 |
Q |
| |
|
|||||| |
|
|
| T |
13751315 |
agttaa |
13751310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University