View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2538_low_9 (Length: 327)
Name: NF2538_low_9
Description: NF2538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2538_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 29 - 238
Target Start/End: Complemental strand, 33187935 - 33187726
Alignment:
| Q |
29 |
acaatataccggttctaactgtatatgtttccgttggtattgagttatgtcaaaatctatgtttattgacatgactttcgttagtataggattaattggg |
128 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
33187935 |
acaatataccggttctaactatatatgtttccgttggtattgagttatgtcaaaacctatgtttattgacatgagtttcgttagtataggattcattggg |
33187836 |
T |
|
| Q |
129 |
atcnnnnnnnaaatattatcgtcttaaagcaggttatttttcctccttttttnnnnnnnnnnnnnnnnntacatcttgatgctagttattttcactcttt |
228 |
Q |
| |
|
||| ||| |||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33187835 |
atcttttgttaaagattatcgtctcaaagcaggttatttttcctccttttttaaaaaataaaaataaaatacatcttgatgctagttattttcactcttt |
33187736 |
T |
|
| Q |
229 |
cctccttgat |
238 |
Q |
| |
|
|||||||||| |
|
|
| T |
33187735 |
cctccttgat |
33187726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University